Внутрииндивидуальная изменчивость гена малой рибосомной субъединицы у осетровых рыб амура Acipenser Schrenckii Brandt, 1869 и Huso Dauricus (Georgii, 1775)

МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ

Федеральное государственное автономное образовательное учреждение

высшего профессионального образования

ДАЛЬНЕВОСТОЧНЫЙ ФЕДЕРАЛЬНЫЙ УНИВЕРСИТЕТ


КУРСОВАЯ РАБОТА

Внутри-индивидуальная изменчивость гена малой рибосомной субъединицы у осетровых рыб амура Acipenser Schrenckii Brandt, 1869 и Huso Dauricus (Georgii, 1775)


Кафу Наталья Михайловна


г. Владивосток


Оглавление

осетровый рыба секвенирование псевдоген

Введение

1. Обзор литературы

1.1Биология, молекулярная эволюция и филогения осетровых рыб

1.1.1Происхождение и разнообразие

.1.2Островые рыбы Амура

.1.3Гены ядерной 18S рДНК

.1.4Согласованная эволюция

1.2Краткая характеристика используемых методов и маркеров

1.2.1Полимеразная цепная реакция

.2.2Автоматическое секвенирование ДНК с флуоресцентной меткой

2. Материалы и методы

2.1Получение геномной ДНК

.2PCR-амплификация 18S рДНК

.3Клонирование 18S pДНК

.4Секвенирование последовательности 18S рДНК

.5Обработка данных секвенирования 18S рДНК

.6Тесты для псевдогенов

3. Результаты и обсуждение

4. Выводы

Список литературы


Введение


Отряд Acipenseriformes (осетры и веслоносы) является древней группой рыб, ведущей свое происхождение из Юрского Периода (Grande, Bemis, 1991). Важными особенностями этой группы рыб являются долгая продолжительность жизни, возможность достижения больших размеров и медленное созревание. Широкое использование осетровых в комерческих целях привело к их масштабному вылову, что резко уменьшило численность этих рыб. В настоящее время весь род включен в списки Международной конвенции по редким видам (CITES). Основными факторами уменьшения численности осетровых рыб являются некоторые биологические особенности этих рыб (прежде всего медленное созревание, размножение с промежутками в несколько лет, миграции), загрязнение и уничтожение естественных мест обитания и нерестилищ, строительство дамб на нерестовых путях и чрезмерный вылов (Krieger et al., 2008; Ludwig, 2008).

Все осетровые являются полиплоидами (4n-8n-16n) и обладают большим (120-500) числом хромосом (Birstein et al., 1993; Fontana et al., 1999). Так же генетические исследования осетровых рыб выявили некоторые особенности, такие как, консервативный характер кариологической (Lanfredi et al., 2001), биохимической (Khabarov et al., 2002) и молекулярной (de la Herran et al., 2001; Krieger, Fuerst, 2000) эволюции, а также множественность аллелей гена ядерной 18S рРНК (Krieger, Fuerst, 2002; 2004), что делает эту группу особенно привлекательной для всестороннего изучения. Эти факторы, возожно, явились причиной относительно простой межвидовой и межродовой гибридизации, усугубляемой перекрытием зон нереста. Гибридизация делает систематику Acipenseridae весьма запутанной (Birstein, 2002).

Предмет нашего исследования - рибосомная ДНК (рДНК) - классический пример генной дупликации, который может быть использован в качестве модели для тестирования теории согласованной эволюции (Hillis, Davis, 1988; Hillis, Dixon, 1991). Эволюционная динамика тандемно-повторяющихся последовательностей мультигенного семейства рДНК вызывает неизменный интерес многих исследователей с момента своего открытия; генные дупликации принято рассматривать как основной эволюционный путь приобретения новых функций (Dame et al., 1984).

Кодирующие регионы рДНК широко используются в качестве молекулярных маркеров для филогенетических исследований эукариот, поскольку большинство их мутаций в результате согласованной эволюции (через механизмы рекомбинации) быстро фиксируются внутри популяции или вида в процессе дифференциации (Hillis, Davis, 1988; Carranza et al., 1996). Интенсивные исследования этих маркеров обнаружили, что у небольшого числа организмов регистрируется несколько (2-3) вариантов ядерного гена 18S рРНК (Kelly, 1997; Muir et al., 2001). Поэтому открытие множественных аллелей этого гена у северо-американских осетровых рыб (род Acipenser) (Krieger, Fuerst, 2002, 2004) оказалось еще более неожиданным; для всех других животных значительная внутри-индивидуальная изменчивость последовательности 18S рДНК не характерна. В настоящее время не существует четкого объяснения данного феномена, а также его отсутствия у ближайших филогенетических родственников осетров, таких как веслоносы (род Polyodon). Среди возможных причин чаще всего приводят полиплоидию (Kelly, 1997; Krieger, Fuests, 2004); бесспорным остается лишь тот факт, что механизмы согласованной эволюции в геномах осетровых рыб не смогли реализоваться в полной мере.

Цель нашей работы состояла в исследовании разнообразия 18S рДНК у двух видов осетровых рыб Амура (Acipenser schrenckii и Huso dauricus), что необходимо для прояснения механизмов генерирующих это разнообразие, а также оценки широты распространения феномена множественности аллелей гена 18S рРНК и его эволюционных последствий у разных представителей животного мира и прежде всего - полиплоидных видов рыб.

В связи с этим были поставлены следующие задачи:

1.Провести амплификацию, клонирование и секвенирование гена 18S рРНК у двух видов осетровых рыб Амура (Acipenser schrenckii и Huso dauricus).

2.По данным секвенирования провести детальный анализ полиморфизма последовательностей 18S рДНК (нуклеотидные замены, вставки/делеции).

.По данным филогенетического анализа дать функциональную характеристику вариантам гена 18S рРНК.

.Провести анализ скоростей эволюции последовательностей с разной функциональной значимостью.


1. Обзор литературы


1.1Биология, молекулярная эволюция и филогения осетровых рыб


1.1.1Происхождение и разнообразие

Осетры относятся к подклассу Лучеперых рыб (Actinopterygii), появившихся около 350 млн лет назад. Тогда лучеперые представляли из себя примитивные группы толсточешуйных ганоидных рыб. Пик численности и разнообразия лучеперых приходился на Пермский и Триасовый периоды. Затем их численность начала сокращаться и в наше время сохранилось около 50 видов этих некогда многочисленных групп (Bemis et al., 1996).

Лучеперые рыбы составляют свыше 95% процентов ныне живущих рыбообразных и рыб. Опору осевого скелета у них образует костный позвоночник, только у немногих сохраняется хорда. Подкласс Actinopterygii делится на Ганоидных рыб (Ganoidomorpha) и Костистых рыб (Teleostei). Ganoidomorpha включает единственный надотряд Ganoidomorfha, с четырьмя отрядами. Костистые рыбы включают 8 надотрядов и 32 отряда. Таким образом, в настоящее время в подкласс Actinopterygii входит 36 отрядов, группируемых в 9 надотрядов. Ганоидные рыбы представляют собой немногочисленные остатки нескольких древних групп, расцвет которых предшествовал расцвету остальных отрядов лучеперых рыб. К ганоидным рыбам относятся:

1.Осетрообразные, или Хрящевые ганоиды (Acipenseriformes, или Chondrostei)

2.Многоперообразные (Polypteriformes)

.Амиеобразные (Amiiformes)

.Панцирникообразные (Lepisosteiformes).

Два последних отряда нередко рассматриваются под общим названием костных ганоидов (Holostei).

В настоящее время отряд Acipenseriformes насчитывает около 24 видов. Из них 4-5 видов находится на грани вымирания, 11 видов под угрозой исчезновения, 9 на грани перехода в статус исчезающих и 1-2 вида находятся в статусе низкого риска. Фауна Российской Федерации представлена 13 видами рыб родов Huso, Acipenser и Pseudoscaphirhynchus.


1.1.2Островые рыбы Амура

Ниже дано краткое описание осетровых рыб реки Амур (систематика, распространение, образ жизни и статус вида).

Acipenser schrenckii Brandt, 1869 - амурский осетр

Другие названия:

Acipenser sturio (non Linnaeus) - Georgi, 1775: 352 (Шилка);schrenckii Brandt, 1869: 115 (бассейн Амура);schenckii - Дыбовский, 1877: 219 (Амур, Уссури, оз. Ханка);schrenckii - Берг, 1909: 20 (бассейн Амура); schrenckii - Богуцкая, Насека, 1996

Описание. По внешнему виду похож на сибирского осетра A. baerii, но жаберные тычинки одновершинные, не веерообразные. Рыло коническое, заостренное. Нижняя губа прервана. В спинном плавнике 35-53 луча, в анальном - 20-32. Спинных жучек 11-17, боковых 32-47, брюшных 6-12. Жаберных тычинок 36-45. Костяной луч грудного плавника очень сильный. Тело между рядами жучек покрыто мельчайшими гребневидными зернышками. Окраска варьирует: спина от серовато-желтой до почти черной, брюхо и бока светлые (Берг, 1948; Никольский, 1956). Относится к 240-хромосомной группе осетров (Васильев, 1985).

Распространение. Бассейн Амура от лимана до верховьев, встречается в Шилке, Аргуни, Ононе, Сунгари, Уссури и оз. Ханка (Берг, 1948; Никольский, 1956). В лимане немногочислен и за пределы опресненной зоны выходит редко, но встречается у берегов Сахалина и заходит в устьевые участки реки северо-западной части острова, изредка попадается в Сахалинском заливе (Атлас пресноводных рыб России, 2002).

Максимальные размеры. Крупный осетр, в прошлом попадались экземпляры длиной до 290 см и массой до 80-160 и даже 200 кг (Берг, 1948). В последние годы в уловах представлены рыбы длинной 90-170 см и массой 6-40 кг в возрасте 12-38 лет.

Образ жизни. Донная промысловая рыба, образующая в Амуре несколько локальных группировок (стад), приуроченных к отдельным участкам реки и впадающим притокам. В лимане Амура обитает немногочисленная полупроходная группировка. Созревает в возрасте не ранее 9-10 лет при длине не менее 108-116 см и массе 6-8 кг. Нерест происходит с конца мая до середины июля на галечниковых участках реки с довольно быстрым течением и глубиной 2-3 м. Плодовитость колеблется в зависимости от размеров самки в пределах 27,6-434 тыс. икринок. Их диаметр 2,5-3,0 мм. Молодь выходит из икры в июне-июле. По достижении длины 2 см она начинает питаться мелкими формами донных беспозвоночных, в основном личинками хирономид. Пищу взрослых осетров составляют более крупные личинки насекомых, мелкая рыба и моллюски (Никольский, 1956).

Статус вида. Ценнейшая промысловая рыба, в прошлом добывалась в значительных количествах. В 1891 г. его уловы доходили до 6 тыс. центнеров, в 1930-е годы они колебались в пределах 140-300 центнеров, с 1945 г. началось резкое снижение уловов, они упали до 8 центнеров (1948). С 1958 г. в бассейне Амура установлен запрет на промысел осетра, который действует и до настоящего времени (китайский лов при этом не прекращался). В начале 70-х годов общая численность осетра в Нижнем муре в возрасте от годовика и старше составила около 145 тыс. экз. (Крыхтин, 1979). За прошедшие годы общая численность амурского осетра не увеличивалась и по последним данным составляет около 130 тыс. экз., но при этом несколько возросло количество взрослых рыб. Их насчитывается около 25 тыс. экз. Вид внесен в Красную книгу МСОП.

В последние десятилетия около 90% популяции составляют молодые неполовозрелые особи 45-65 см длинной; общая численность рыб старше 2 лет - 2000 экз, а производители встречаются единичными экземплярами. Основными ограничивающими факторами, скорее всего, являются ограниченный фонд нерестилищ, интенсивный китайский промысел, загрязнение бассейна Амура (добыча гравия). Основные меры по увеличению численности этого вида - охрана нерестовых рек, работы по искусственному воспроизводству, криоконсервация генома, усиление борьбы с загрязнением вод бассейна Амура.

Huso dauricus (Georgi, 1775) - калуга

Другие названия:

Acipenser dauricus Georgi, 1775: 352 (Амур, Аргунь, Шилка, Онон).orientalis Pallas, 1814: 107 (Амур).dauricus - Берг, 1911: 146 (Амур, Шилка, Онон); - Берг, 1948: 58.

Описание. Рот большой, полулунной формы, частично переходящий на бока головы. Спинных жучек - 10-16, боковых - 32-46, брюшных - 8-12. В спинном ряду первая жучка наименьшая. Жаберных тычинок 16-22. В спинном плавнике менее 60 лучей (43-57), в анальном - 26-35. Усики сплющены с боков. Жаберные перепонки сращены между собой. Окраска спины серовато-зеленая или серовато-черная, брюхо желтовато-белое или белое (Берг, 1948; Никольский, 1956). Относится к 120 хромосомной группе осетров (Васильев, 1985).

Распространение. Населяет бассейн Амура от лимана до Шилки, Аргуни и Онона. Есть в Сунгари и Уссури. Изредка заходит в озера (Ханка, Болонь, Орель) (Берг, 1948; Никольский, 1956). Молодь обнаружена в северо-западной части Охотского моря, вблизи устьев рек Тауй, Охота, Ульбея, Иня и др. (Черешнев, 1990). Известна калуга у северо-западного побережья Сахалина, (Гриценко, Костюнин, 1979); а также в Сахалинском заливе и в некоторых лагунах северо-восточной части острова (Пильтун, Чайво, Ныйский). Отмечены случаи поимки калуги у берегов Хоккайдо (Атлас пресноводных рыб России, 2002).

Максимальные размеры. Крупнейшая пресноводная рыба, достигающая длины 5 м и массы более 1000 кг. Наиболее крупные особи сосредоточены в лимане Амура. В 1935 г. средняя масса добываемых калуг составляла 114 кг (Никольский, 1956). В 1997-1998 гг. в контрольных уловах в русле Амура калуга была представлена особями длиной от 160-260 см, массой от 20 до 140 кг в возрасте от 12 до 26 лет. В лимане Амура модальные размеры добываемых рыб составили 200-240 см, масса 100-120 кг, возраст 19-28 лет.

Образ жизни. В бассейне Амура образует полупроходную (лиманную) и жилую формы, последняя представлена наиболее крупными особями, обладает более высоким темпом роста и имеет яровую и озимую расы. Растет быстро: лиманная форма к 11-13 годам имеет массу 45 кг, а к 20-22 годам ее масса превышает 100 кг. Возраст созревания сильно растянут. Самки калуги в Среднем Амуре становятся половозрелыми на 11-21-м году жизни при достижении массы 37-110 кг, самцы - на 10-19-м году при массе 26-90 кг. Жилая форма созревает на несколько лет позже: самцы в возрасте 14-21 год, самки - на 17-23-м году жизни. Нерест у одной и той же особи не ежегодный: у самцов интервал составляет в среднем 4 года, у самок - 5 лет. Размножается, как и все осетровые, на галечниковом или песчаном грунте, откладывая донную, приклеивающуюся икру. Плодовитость от 665 до 4100 тыс. икринок. Зрелые икринки имеют диаметр 3,2-4,0 мм. Сроки нереста - май-июнь при температуре воды 12-14°С. Иногда нерест затягивается до июля. Инкубационный период длится 4-6 суток. Вышедшие из икры личинки сносятся вниз по течению Амура, делая, как и все осетровые, характерные свечки, поднимаясь резким движение от дна в толщу воды, а затем опускаясь на дно.

Мальки калуги питаются донными личинками насекомых, креветками, мизидами и очень рано переходят на питание рыбой. Небольшие калужата поедают пескарей, молодь чебака и даже косаток. Взрослая калуга после нереста интенсивно откармливается. В лимане Амура ее пищу составляют дальневосточные лососи (кета, горбуша) во время их нерестового хода в реку. Жилая туводная форма калуги питается пескарями, чебаком, белым амуром, толстолобиком, сазаном и другими рыбами. У калуги отмечен каннибализм: крупные особи нередко поедают молодь своего вида. Зимой калуга концентрируется на ямах, но питаться не прекращает (Никольский, 1956; Атлас пресноводных рыб России, 2002).

Статус вида. Ценнейшая промысловая рыба. В конце XIX-ого века в низовьях Амура ее вылов достигал 580 т. (Никольский, 1956). Запасы калуги были подорваны еще на рубеже XIX-ого и XX-ого веков. Лов осуществлялся самоловной крючковой снастью и крупноячеиными сетями-аханами. К 30-40-м годам XX-ого века уловы упали до 30-80 т. С 1958 г. в бассейне Амура со стороны России промысел осетровых был запрещен, и стадо калуги стало постепенно восстанавливаться.

С 1976 г. открыт строго регламентированный ее промысел в лимане, а с 1991 г. и в русле Амура. Общая численность особей калуги старше одного года в русле и лимане Амура составляет сейчас 100-130 тыс. экз. Промысловый запас лиманной калуги в настоящее время оценивается примерно в 1000 т. Если лиманная форма находится в относительно благополучном состоянии, то этого нельзя сказать о ее речных группировках. Калуга, как и все виды осетровых, включена в Красную книгу МСОП.

Зейско-бурейская популяция калуги занесена в Красную книгу Российской Федерации (2001) (категория 1). Её численность в возрасте 2 года и старше, видимо, не превышает 2000 экз. и неуклонно сокращается. Основная причина снижения численности - чрезмерный вылов в китайских водах и браконьерство в нашей стране, загрязнение вод Амура и его притоков и добыча гравия на нерестилищах калуги. Необходимо заключение межгосударственного соглашения с Китаем об охране редких видов, строительство рыбозавода для искусственного разведения и усиления борьбы с загрязнением вод бассейна Амура для сохранения и увеличения численности популяций.


1.1.3Гены ядерной 18S рДНК

Рибосомная ДНК (рДНК) кодирует рибосомные РНК, которые, совместно с рибосомными белками, образуют рибосомы, т.е. структуры, на которых происходит синтез белков. В эукариотических клетках три гена рРНК расположены вместе, в одной транскрипционной единице: 18S - ген малой субъединицы, 28S - ген большой субъединицы, и ген 5.8S рРНК (рис. 7). При транскрипции образуется единая цепь рРНК, которая затем разделяется на три отдельные молекулы. Транскрипционные единицы рДНК могут находиться на нескольких хромосомах как тандемно-повторенные последовательности. Местом локализации рДНК на хромосомах являются ядрышкообразующие регионы (ЯОР). Количество копий рибосомной ДНК может меняться от одной, как у Tetrahymena (Yao, Gall, 1997), до нескольких сотен и даже тысяч у высших эукариот (Apples et al., 1980). С 5-конца гены рРНК ограничены внешним транскрибируемым спейсером (ETS), кодирующие участки разделены двумя внутренними транскрибируемыми спейсерами (ITS-1 и ITS-2). Межгенный спейсер (IGS) разделяет тандемные повторы транскрипционных единиц рибосомной ДНК. В отличие от консервативных кодирующих участков, спейсеры, особенно межгенные, эволюционируют быстро, преимущественно за счет замены оснований, а также делеций, инсерций, или дупликаций сегментов ДНК (Arnheim, 1983).

Хотя гены рРНК играют важную роль в эволюционном процессе, из-за большого количества их копий существовало мнение, что эти гены могут эволюционировать независимо. Однако исследования показали, что семейства генов рРНК эволюционирует не-независимо. Внутри одной особи или одного вида копии рДНК идентичны, различия наблюдаются при сравнении семейств рибосомных генов между видами. Процесс гомогенизации повторенных последовательностей носит название согласованной эволюции (Arnheim et al., 1980; 1983).

Действие согласованной эволюции не направлено непосредственно на создание множества копий генов рРНК, полностью идентичных друг другу. Действительно, с накоплением информации о генах рибосомальной РНК появляются данные об организмах, в геноме которых существуют множественные варианты рДНК. Гены рРНК являются наиболее консервативными вследствие функциональных ограничений. Самым консервативным признается ген 18S рРНК (Hillis, Dixon, 1991). Участки рибосомных генов показывают наибольшую (если не полную) гомогенность последовательностей у организмов и видов в целом. Однако существуют и исключения. Например, два варианта рДНК были найдены у паразитического простейшего Plasmodium (см.: Dame et al., 1984; Gunderson et al., 1987; Waters et al., 1989; Qari et al., 1994). Предполагают, что они специфичны к стадиям развития. Позже, у плоского червя Dugesia mediterranea были обнаружены два типа гена 18S рРНК (Carranza et al., 1996). Однако, в отличие от Plasmodium, у него наблюдается экспрессия только одного варианта гена. Две различные последовательности 16S рРНК были найдены у четырех видов бактерий (Liefting et al., 1996; Wang et al., 1997; Reischel et al., 1998; Yap et al., 1999), а также у архебактерии Haloarcula marismortui (Mylvaganam, Dennis, 1992). Следует отметить, что присутствие двух вариантов гена РНК малой субъединицы рибосом у бактерий не аналогично двум вариантам гена 18S рРНК в геноме эукариот, поскольку рибосомные гены прокариот не образуют тандемных повторов.

Филогенетическая ценность гена РНК малой рибосомной субъединицы состоит в том, что он, с одной стороны, имеет консервативные участки, позволяющие провести выравнивание последовательностей различных видов, даже в случае низкой степени их родства. С другой стороны, вариабельные участки гена являются филогенетически информативными и используются для определения филогенетических отношений между родственными видами (Hillis, Dixon, 1991) и таксонами высокого ранга.

Проведенное исследование гена 18S рРНК у 10 видов северо-американских осетровых рыб выявило, что у некоторых из них наблюдается множественность аллелей исследуемого гена (Krieger, Fuerst, 2002). В результате частичного секвенирования 33 клонов гена малой субъединицы озерного осетра (A. fulvescens) было обнаружено 17 вариантов последовательностей. Эти варианты были полностью секвенированы и из 1783 сайтов 159 показали изменчивость. В тоже время, секвенирование гена 18S рРНК веслоносов (Polyodon spathula) не выявило наличия генных вариантов. При сравнении последовательностей обнаружено, что лишь один из клонов 18S рДНК озерного осетра является наиболее близким к последовательности гена веслоносов, отличаясь от него всего одной нуклеотидной заменой. Исследователи полагают, что множественные варианты рибосомных генов появились у осетровых после расхождения семейств Acipenseridae и Polyodontidae.

Существует несколько вероятных причин наличия у осетровых рыб множественности аллелей гена 18S рРНК. Первая - это тканеспецифичность генных вариантов. По данным Кригер с соавторами (Krieger et al., 2004) Af-7 является основным вариантом, экспрессируемым в тканях печени. В других тканях в качестве основных аллелей могут выступать другие варианты. Для проверки этой гипотезы необходимо детальное исследование экспрессии рРНК во всех тканях осетровых рыб. Однако самим исследователям этот вариант не кажется приемлемым, т.к. при наличии, как минимум, 17 вариантов гена 18S рРНК, следует предположить наличие 17 типов тканей, использующих эти варианты. Маловероятно, что такому количеству тканей необходимо столько вариантов специально адаптированных рибосом. Хотя возможность того, что несколько вариантов все же могут быть тканеспецифичными полностью исключить нельзя. Тогда зачем нужны остальные аллели? Если допустить, что все 17 вариантов действительно тканеспецифичны, то вероятность того, что клон Af-7 экспрессируется только в печени равна 1 к 17, или около 6% (Krieger, 2002).

Второй возможной причиной данного феномена может являться специфичность некоторых, а возможно и всех, вариантов к стадиям развития организма. Например, у малярийного плазмодия существует два типа рРНК, поскольку его цикл развития проходит через две стадии (Dame et al., 1984; Gunderson et al., 1987; Waters et al., 1989; Quari et al., 1994; Rogers et al., 1995). Поскольку осетровые рыбы не имеют подобных стадий развития, то необходимость нескольких вариантов 18S рРНК можно допустить лишь для анадромных видов. Но ареал озерного осетра, у которого впервые и был обнаружен этот феномен, ограничен пресными водами Великих и некоторых других озер юга Канады. Очевидно, что данная гипотеза также не подходит для объяснения множественности аллелей гена 18S рРНК. Основным фактором, способствующим происхождению и поддержанию множественности копий гена 18S рРНК, по мнению большинства авторов, считается полиплоидная природа генома осетровых рыб (см.: Dingerkus, Howell, 1976; Birstein, Vasiliev, 1987; Birstein et al., 1993; Blacklidge, Bidwell, 1993; Fontana, 1994; Fontana et al., 1998).

Происхождение множества копий гена 18S рРНК может быть следствием полиплоидизации генома осетровых рыб, развивавшейся по одному из двух путей. Во-первых, полиплоидизация, в результате межвидовой гибридизации, могла свести вместе различные родительские аллели, вызвав тем самым внутри-индивидуальную изменчивость. Однако маловероятно, что наличие такого феномена связано только с комбинацией родительских аллелей (Krieger, 2002). Для этого необходимо, чтобы в родительских геномах также содержались различные копии гена 18S рРНК. Существуют данные (Birstein, DeSalle, 1998), что у предков осетровых рыб внутри-индивидуальная изменчивость этих генов отсутствовала. Альтернативный путь может заключаться в том, что в результате авто- или аллополиплоидизации увеличилось число хромосом и кластеров рДНК. Ослабленное действие отбора позволило некоторым из копий рДНК стать нефункциональными вариантами, поскольку не все копии гена 18S рРНК необходимы для обеспечения жизнедеятельности клетки.

Инактивация некоторых локусов рДНК в процессе диплоидизации полиплоидных геномов осетров могла стать еще одной причиной появления множественных вариантов гена 18S рРНК, поскольку действие отбора на инактивированные кластеры рДНК ниже, чем на функциональные аналоги (Krieger, 2000). Подвергшиеся диплоидизации полиплоидные виды имеют дуплицированный геном, но уровень экспрессии генов тот же, что и у диплоидов (Ohno, 1970; Leipoldt, 1983). Происходит это путем инактивации избыточных копий генов полиплоидного генома для поддержания нормального уровня экспрессии генов. Избыточные копии также могут подвергаться функциональной модификации, превращаясь в новые локусы (Ohno, 1970). Накопление мутаций в копиях может, в конечном счете, привести или к ослаблению экспрессии гена или к созданию новых функциональных локусов (Krieger, 2000). В некоторых случаях, инактивированный генетический материал может с течением времени элиминироваться из генома, уменьшая его размер (Hinegardner, 1976; Ferris, Whitt, 1977).

Очевидно, что некоторые повторы рДНК должны сохранять свою консервативность для нормальной жизнедеятельности клетки. Наличие функциональных последовательностей гена 18S рРНК A. fulvescens говорит о том, что механизмы согласованной эволюции, в некоторой степени, воздействуют на повторы рДНК. Тогда почему действие согласованной эволюции не распространяется на все повторы рДНК, как это происходит у большинства организмов? Точного ответа на этот вопрос пока не существуют, но данные анализа изменчивости гена 18S рРНК озерного осетра (Krieger, 2000; Krieger et al., 2002, 2004) позволяют сделать некоторые предположения о факторах, влияющих на согласованную эволюцию. Работа этих факторов, возможно, согласована.

Одно из предположений заключается в том, что с момента возможной гибридизации/полиплоидизации прошло меньше времени, чем требуется механизмам согласованной эволюции для гомогенизации рДНК, или скорость гомогенизации ниже ожидаемой. Если детальное исследование всех ЯОР позволит обнаружить в них большинство из зарегистрированных вариантов гена 18S рРНК, это будет являться доказательством протекающего процесса гомогенизации рДНК у осетровых рыб.

Интересным является тот факт, что у веслоносов, также имеющих полиплоидный геном (Dingerkus, Howell, 1976), внутри-индивидуальная изменчивость 18S рРНК отсутствует (Krieger, Fuerst, 2002, 2004). Для объяснения эволюции осетровых рыб Васильевым (Vasilev, 1999) был предложен возможный сценарий сетчатого видообразования. По его мнению, различные виды могли произойти в разное время и к настоящему времени достигнуть различных уровней функциональной и структурной диплоидизации. Если полиплоидные веслоносы произошли раньше, чем осетровые рыбы, у них могло быть больше времени для диплоидизации, освобождающей геном от нефункциональных последовательностей рДНК (гипотеза 1). Накопление мутаций в некоторых кластерах рДНК могло препятствовать отжигу праймеров, делая невозможным дальнейшую амплификацию (гипотеза 2). Более раннее происхождение веслоносов могло дать согласованной эволюции достаточно времени для гомогенизации всех последовательностей рДНК в геноме (гипотеза 3). Во втором случае вариантные аллели все еще могут существовать, но мутации не позволяют обнаружить их методами PCR-анализа. Уровень диплоидизации в этом случае можно измерить путем аллозимного анализа. Если экспрессия дуплицированных генов все еще имеет место, они проявятся на геле в виде дополнительных полос. Такой анализ был проведен для Polyodon spathula (Carlson et al., 1982) и атлантического осетра (A. stellatus) (Ryabova, Kutergina, 1990). Результаты исследований выявили различный уровень диплоидизации у этих видов. Уровень экспрессии дуплицированных локусов был наибольшим у веслоноса - 6% (высший уровень диплоидизации) и наименьшим у атлантического осетра - 31% (низший уровень диплоидизации). Эти данные согласуются с наблюдаемой у осетров изменчивостью гена 18S рРНК. Они также согласуются с предположением о том, что диплоидизация у веслоносов шла более интенсивно, чем у осетров (возможно в результате более раннего происхождения). Пониженная изменчивость гена у рода Scaphirhynchus может указывать на меньшее число вариантов гена 18S рРНК, что позволяет прочитать последовательность напрямую с PCR продукта. Вполне возможно, что лопатоносы являются промежуточной стадией диплоидизации между осетрами и веслоносами. Проверить вышеупомянутые гипотезы можно путем окрашивания серебром и флуоресцентной in situ гибридизацией ЯОР.

Четвертая гипотеза может состоять в том, что локусы рДНК у веслоносов имеют другое, нежели у осетровых, положение на хромосомах, что, в свою очередь, позволяет механизмам согласованной эволюции гомогенизировать все варианты последовательностей в один (Krieger, 2000). Количество и расположение кластеров рДНК веслоносов к настоящему времени неизвестно, но если они находятся на нескольких гомологичных хромосомах, взаимодействие между ними в процессе мейоза может облегчить гомогенизацию вариантов рДНК. Как и в предыдущем случае, эту гипотезу можно проверить серебряным окрашиванием ЯОР.


1.1.4Согласованная эволюция

Большая часть генома эукариот - это повторяющиеся последовательности, в частности, более трети генома человека состоит как из отдельно, так и тандемно-повторяющихся последовательностей ДНК, которые могут занимать до 10% генома, большинство из которых - некодирующие. Геномная организация повторяющихся последовательностей ДНК может быть разной: 1. короткие последовательности, включенные в разные части генома (SINEs), длинные последовательности, включенные в разные части генома (LINEs), и мобильные элементы, как гены тРНК и гены гистонов, которые могут группироваться в одном или нескольких участках хромосом. Мультигенные семейства, в том числе рибосомная РНК (рРНК), малые ядерные РНК (мяРНК), а также некодирующие последовательности, такие как мини- и микросателлитной ДНК, часто расположены в тандеме. Несмотря на обилие повторяющихся ДНК в геноме эукариот, их биологические функции остаются неясными. Однако, большинство повторяющихся последовательностей, будь то кодирующие или некодирующие, проявляют неожиданные свойства: они развиваются согласованным образом. Хотя, тандемные повторы сравниваются в пределах вида, а не между видами, предполагается, что они развиваются независимо друг от друга.

Молекулярный процесс, который приводит к усреднению тандемно-повторяющихся последовательностей ДНК, называется "согласованной эволюцией". Согласованная эволюция - это универсальным биологическим механизмом эволюции. У многих видов, начиная от бактерий, заканчивая млекопитающими, до настоящего времени процесс гомогенизации генов не закончен. Например, расхождение между тандемами генов 16S рДНК разных штаммов Е. coli. всего лишь 0,192%, тогда как между E. сoli и H. influenzae - 5,90 %. Но в большинстве организмов согласованная эволюция завершилась. Механизм гомогенизации хорошо описан на примере локуса RNU2 приматов, который кодирует U2 мяРНК. Было доказано, что повторы гена U2, появившиеся у древних родственников приматов, стабилизировались более 35 миллионов лет и эволюционировали в согласованной форме в различных линиях приматов. В частности, обезьяны Старого Света (бабуины, макаки) имеют повторяющуюся единицу U2 размером 11 т.п.н. (тысяч пар нуклеотидов), в то время как гоминоиды (гиббоны, орангутанги, гориллы и шимпанзе) и люди имеют размер этого же блока 6 т.п.н. Впоследствии было доказано, что разница в 5 т.п.н. повторяющегося U2 блока между обезьянами Старого Света и гоминоидами связана с удалением 5 т.п.н. последовательности из 6 т.п.н. провируса, оставив длинный концевой повтор (LTR) в 1 т.п.н. Таким образом, согласованной эволюцией распространяется делеция более 5 т.п.н. из одного повтора всех копий в геноме гоминоидов. Согласованная эволюция также наблюдалась в белок-кодирующих мультигенных семействах, например, кодирующих гистоны и убиквитин, а также в некодирующих последовательностях, начиная от огромных альфа-сателлитных до простых повторов.

Огромное сходство повторяющихся последовательностей внутри вида, а не между видами, может свидетельствовать о том, что существуют механизмы, поддерживающие гомогенным состав тандемных повторов. Внутривидовые гомогенные тандемные последовательности считаются результатом ряда рекомбинаций ДНК, репараций, репликаций, генных конверсий, амплификаций и неравного кроссинговера между повторяющимися последовательностями.

Недавние исследования мультигенного семейства, кодирующего мяРНК U2 и рРНК заставили иначе взглянуть на механизмы согласованной эволюции. Человеческий локус RNU2 состоит из нескольких тандемных повторов длинной 6,1 т.п.н. и находится только в одном участке хромосомы 17q21-22, только на конце локуса BRCA1 (рис. 1). Число копий гена U2 изменяется в широких пределах отдельных лиц и населения, начиная от 5 до более 30 копий в тандеме, что свидетельствует о высоком уровне рекомбинаций внутри или между локусами RNU2. Анализ нескольких полиморфных маркеров показал, что отдельные повторы гена U2 являются полностью однородными для конкретных полиморфных аллелей, хотя различные аллели каждого маркера могли произойти в любой комбинации. Таким образом, гомогенизация последовательностей происходила, в основном, вдоль хромосомных линий. С учетом этих результатов, предполагается, что основной движущей силой согласованной эволюции тандемно-повторяющихся мультигенных семейств является внутрихромосомная гомогенизация. Межхромосомные генетические обмены встречаются гораздо реже и протекают по типу генной конверсии.

При изучении полиморфизма внутреннего транскрибируемого спейсера в популяциях дрозофилы Drosophila melanogaster показано, что индивидуальные последовательности рДНК в разных полиморфных аллелях гомогенизированы. Это указывает на более высокие скорости внутрихромосомных рекомбинаций по сравнению со скоростью рекомбинаций между гомологичными хромосомами.

Специфические механизмы, ответственные за внутрихромосомную гомогенизацию, неизвестны, но в любой внутрихромосомной конверсии генов или неравном обмене сестринских хроматид (unequal sister-chromatid exchange - USCE), в принципе, происходят внутрихромосомные рекомбинации по механизму согласованной эволюции. Из-за отсутствия взаимного обмена в маркерах, фланкирующих тандемный массив, наиболее вероятным механизмом межхромосомного генетического обмена является генная конверсия. Генной конверсией является нереципрокная передача генетической информации между аналогичными последовательностями, в которых обмена фланкирующими участками ДНК не происходит. Генная конверсия очень точна, она приводит к гомогенизации только специфических регионов ДНК, таких как кодирующие последовательности (при этом наличие малых фланкирующих последовательностей не требуется для эффективной генной конверсии). Частота межхромосомной конверсии генов не должна быть высокой. Это доказывает, что генная конверсия ответственна за гомогенизацию диспергированных генов у бактерий и дрожжей. Таким образом, разумно предположить, что генная конверсия является общим механизмом, который ответственен за согласованную эволюцию всех диспергированных генов.


Рис. 1. Модель молекулярного механизма согласованной эволюции. А) Организация тандемных повторов человеческого гена U2 мяРНК (локус RNU2). На схеме показаны элементы, содержащиеся в повторе гена U2, включая две тандемно-повторенные последовательности Alu, LTR, СТ-микросателлит и урезанный элемент L1. Кодирующий регион U2 мяРНК обозначен белой стрелкой. D - DraI, Eco - EcoRI, H2 - HincII, H3 - HincIII, K - KpnI. B) Модель консеративной эволюции на примере мультигенных семейств.


На схеме показано две тандемно-повторяяющихся последовательности, включающих их фланкирующие ДНК. Кодирующие последовательности обозначены белыми стрелками, а межгенные спейсеры - линиями. Фланкирующие последовательности двух массивов отмечены или заштрихованным или черным прямоугольником.

Динамика распространения видоспецифичных мутаций будет зависеть от скорости рекомбинации внутри и между хромосомами и будет предметом как естественного отбора так и случайного генетического дрейфа. Одна из точек зрения гласит, что согласованная эволюция мультигенных семейств не может быть просто результатом стохастических рекомбинаций, но, скорее, может отражать требования клетки к гомогенности повторяющихся последовательностей.

Механизм согласованной эволюции, описанный выше, основан на исследованиях мультигенных семейств. Модель гомогенизации, относящаяся к повторяющимся некодирующим ДНК, неизвестна, хотя теоретически согласованная эволюция повторяющихся последовательностей некодирующей ДНК может, по большому счету, проходить через подобные механизмы. Тем не менее, важно иметь в виду, что, хоть некоторые повторяющиеся некодирующие последовательности обладают очевидной однородностью, многие из них могут отображать активную амплификацию и транспозицию, а не активную гомогенизацию последовательностей. Прекрасным примером является анализ мультигенных семейств иммунной системы позвоночных.

Дублирование ДНК последовательности считается основным источником новых генов в эволюции. Дублированные гены могут расходиться и приобретать новые функции, или они могут стать функционально инактивированными и оставаться в геноме как псевдогены. Третьим вариантом может быть сохранение их в первоначальном виде; последним вариантом гомогенизации этих последовательностей выступает согласованная эволюция, чтобы замедлить генетическое и функциональное разнообразие. Очевидно, что появление генетического разнообразия показывает, что процесс гомогенизации не является универсальным. Теперь ясно, что не все повторяющиеся семейства подвергаются согласованной эволюции, как обсуждалось выше (Nei et al., 1997).

Согласованная эволюция - это фундаментальный процесс, происходящий во всех организмах. Изучение мультигенных семейств, таких как рДНК и мяРНК в различных популяциях является необходимым для получения полезной информации о динамике мультигенов из популяций, что даст ключ к разгадке механизма согласованной эволюции (D. Liao, 1999).


1.2Краткая характеристика используемых методов и маркеров


1.2.1Полимеразная цепная реакция

Полимеразная цепная реакция - это метод, имитирующий естественную репликацию ДНК и позволяющий обнаружить единственную специфическую молекулу ДНК в присутствии миллионов других молекул. Открытие метода полимеразной цепной реакции (PCR) стало одним из наиболее выдающихся событий в области молекулярной биологии за последние десятилетия, что позволило поднять молекулярную биологию на качественно новый уровень.

Впервые состав реакционной смеси для постановки полимеразной цепной реакции, и принципы использования праймеров (коротких искусственно синтезированных цепочек ДНК) для получения копий ДНК были описаны в 1971 году. Однако тогда еще не была продемонстрирована основная черта PCR - экспоненциальное увеличение количества копий фрагмента исходной ДНК как результат реакции.

В 1983 году Кэрри Мюллисом (Mullis, 1983) был предложен метод, ставший в дальнейшем известным как полимеразная цепная реакция. Суть метода заключается в многократном копировании (амплификации) в пробирке определенных участков ДНК в процессе повторяющихся температурных циклов. На каждом цикле амплификации синтезированные ранее фрагменты вновь копируются ДНК-полимеразой. Благодаря этому происходит многократное увеличение количества специфических фрагментов ДНК в миллиарды раз, что значительно упрощает дальнейший анализ.

Полимеразная цепная реакция - метод амплификации ДНК in vitro, с помощью которого, в течение нескольких часов, можно выделить и размножить определённую последовательность ДНК в миллиарды раз. Возможность получения огромного количества копий одного строго определённого участка генома значительно упрощает исследование имеющегося образца ДНК.

Для проведения полимеразной цепной реакции необходимо соблюдение ряда условий:

Наличие в реакционной смеси следующих компонентов:

1Праймеры - искусственно синтезированные олигонуклеотиды, имеющие, как правило, размер от 15 до 30 п.н., идентичные соответствующим участкам ДНК-мишени. Они играют ключевую роль в образовании продуктов реакции амплификации;

2Taq-полимераза - термостабильный фермент, обеспечивающий достраивание 3-конца дочерней цепи ДНК согласно принципу комплементарности;

Смесь дезоксинуклеотидтрифосфатов (дНТФ), (дАТФ), (дГТФ), (дЦТФ) и (дТТФ) - "строительный материал", используемый Taq-полимеразой для синтеза второй цепи ДНК;

Буфер - смесь различных компонентов в определенной концентрации, обеспечивающих оптимальные условия для реакции, а также стабильное значение pH;

Анализируемый образец - подготовленный к внесению в реакционную смесь препарат, содержащий искомую ДНК, служащую мишенью для последующего многократного копирования. При отсутствии ДНК-мишени специфический продукт амплификации не образуется.

Циклический температурный режим.

Если в анализируемом образце присутствует искомая ДНК, то в процессе реакции амплификации с ней происходит ряд событий, обеспечиваемых определенными температурными циклами. Каждый цикл амплификации состоит из трех этапов, описанных ниже:

Денатурация. На первом этапе необходимо денатурировать ДНК, находящуюся в образце. Для этого реакционную смесь нагревают до 92-95°С, в результате чего двухцепочечные молекулы ДНК расплетаются с образованием двух одноцепочечных молекул.

Отжиг. На втором этапе праймеры присоединяются к одноцепочечной ДНК-мишени. Этот процесс носит название "отжиг" ("annealing"). Праймеры выбирают так, что они ограничивают искомый фрагмент и комплементарны противоположным цепям ДНК. Отжиг происходит в соответствии с правилом комплементарности Чаргаффа. Если это правило не соблюдено, то отжига праймеров не происходит.

Элонгация (синтез). На третьем этапе температуру в реакционной смеси доводят до оптимума работы Taq-полимеразы (72°С), и синтез дочерней цепи продолжается с максимальной эффективностью.

В дальнейшем этапы денатурации, отжига и элонгации многократно повторяются (30 и более раз). На каждом цикле количество синтезированных копий фрагмента ДНК удваивается.

Результатом циклического синтеза является экспоненциальное увеличение количества специфического фрагмента ДНК. Фактически же значение эффективности отдельных циклов амплификации составляет 78-97%. В случае присутствия в пробе ингибиторов реакции это значение может быть намного меньше. Специфические фрагменты, ограниченные на концах праймерами, впервые появляются в конце второго цикла, накапливаются в геометрической прогрессии и очень скоро начинают доминировать среди продуктов амплификации.


1.2.2Автоматическое секвенирование ДНК с флуоресцентной меткой

Автоматическое секвенирование с помощью флуоресцентно меченых дидезокситерминаторов является последним достижением в области PCR-секвенирования ДНК на сегодняшний день. В 1986 году Худ с соавторами предложили метод секвенирования ДНК, в котором радиоактивное мечение, авторадиография и визуальное чтение нуклеотидов были заменены, соответственно, на флуоресцентные метки, чтение нуклеотидов с помощью лазера, индуцирующего эти метки и компьютерную обработку данных (Smith et al., 1986; Hood et al., 1987). Предложенный метод заключался в том, что к секвенирующему праймеру присоединяли одну из четырех флуоресцентных меток и запускали в реакцию с определенным типом дидезоксинуклеотидтрифосфатами (ддНТФ) и остальными дезоксинуклеотидтрифосфатами (дНТФ). Одновременно проводилось четыре таких реакции с каждым из ддНТФ и праймером, несущим одну из четырех флуоресцентных меток. После этого продукты реакций разделялись в полиакриламидном геле высокого разрешения. На пути миграции меченых фрагментов располагался четырехцветный лазерный детектор, который индуцировал каждую из меток. Флуоресцентный сигнал сразу же передавался на компьютер, где обрабатывался компьютерной программой, после чего выводился окончательный результат - нуклеотидная последовательность фрагмента ДНК. Позже этот метод был модифицирован Пробером с соавторами (Prober et al., 1987), предложившим наносить метку на дидезокситерминаторы вместо праймеров. Для каждого из ддНТФ был разработан флуоресцентный краситель своего цвета со смещенной длиной испускаемой волны. Такой способ мечения дидезокситерминаторов позволил осуществлять проведение циклической PCR в одной микропробирке, содержащей все четыре ддНТФ и электрофорез на одной дорожке геля (Prober et al., 1987). В начале 90-х годов были разработаны новые флуоресцентные красители для ддНТФ, которые представляли собой производные родамина (dichloroROX для ddG, dichloroR6G для ddA, dichloroR110 для ddC и dichloroTAMRA для ddT); был усовершенствован этап электрофореза и детекции меченых продуктов. Также в начале 90-х годов Свердлов сообщил об успешном применении капилляров, для электрофореза при секвенировании ДНК. Капилляр представлял собой микротрубочку с внутренним диаметром 50 мкм, заполненный полиакриламидным гелем. Такой капилляр позволял более эффективно разгонять меченые PCR продукты из-за высокого значения соотношения площади поверхности к объему трубки. Электрофорез при этом осуществлялся при высоком напряжении, что позволило существенно сократить время "чтения" цепи ДНК. Вскоре капиллярный электрофорез был также усовершенствован посредством использования специального полимера низкой вязкости, способного заполнять пространство капилляра при относительно низком давлении (Ruiz-Martinez et al., 1993). Это свойство наполнителя сыграло ключевую роль в полной автоматизации секвенирования ДНК. Полиакриламидный гель - это так называемый поперечно-связанный полимер (гель, представляющий собой сеть из продольных и поперечных стабилизирующих связей) с высокой степенью вязкости. Заменить такой полимер представлялось невозможным, поэтому смена капилляра с полимером осуществлялась вручную. Специальные полимеры, например POP-4, не имеют поперечных стабилизирующих связей, поэтому их вязкость достаточно низка, что позволяет автоматически заменять его после пробега реакционной пробы, не меняя капилляра. Кроме того, такой полимер сохраняет свою структуру при температуре до 60°С, что обеспечивает высокое качество данных секвенирования (Zhang et al., 1995).


2. Материалы и методы


Материалом для исследования послужили 4 образца осетровых рыб из природных популяций реки Амур (Хабаровский филиал ТИНРО-центра).


.1 Получение геномной ДНК


ДНК получали из печени, фиксированной в 80% этаноле. Печень гомогенизировали в ТЕ-буфере (0.01 М TRIS, 0.5 M EDTA, ph=8.0), экстракцию проводили по стандартной методике (Маниатис и др., 1984) с использованием протеиназы К и последующей депротеинизацией фенолом и хлороформом, а также переосаждением изопропиловым и этиловым спиртами. Фиксированную ткань подвергали трехкратной промывке в 70% спирте, с последующей двухкратной промывкой в растворе SSC (0.15 M NaCl + 0.015 M цитрат Na) +0.1 М ЭДТА, pH=8.0. Затем ткань гомогенизировали в этом же растворе с последующим добавлением 10% SDS до 1%. Экстракцию ДНК из печени проводили также. Для проведения PCR геномную ДНК растворяли в ТЕ-буфере и хранили при +4°С.


2.2 PCR-амплификация 18S рДНК


Для аплификации полноразмерного гена малой рибосомной субъединицы использовали праймеры, разработанные для озерного осетра. PCR-амплификацию проводили в 20 мкл реакционной смеси, содержащей 100мМ Tris-HCl (pH=8.3), 500 мМ KCl, 0.25 мМ каждого dNTP, 90 нг тотальной ДНК, 10 pM каждого праймера, 1.5 мМ MgCl2 и 1 ед. смеси Taq/Pfu (8/1). Условия реакции: начальная денатурация - 94°C-3 мин, затем 35 циклов - 94°С-1 мин, 55°C-2 мин, 68°C-4 мин; дополнительный синтез 72°C-15 мин. Реакция завершалась охлаждением смеси до 4°C.

Рис. 2. Транскрипционная единица рДНК в тандемных повторах различных (гомологичных и/или негомологичных) хромосом. ETS - внешний транскрибируемый спейсер, ITS - внутренний транскрибируемый спейсер; IGS - нетранскирибируемый спейсер. На детализации РНК малой рибосомной субъединицы показаны использованные для амплификации и секвенирования праймеры, а также их ориентация (по Krieger, Fuerst, 2002).


Таблица 1. Список использованных праймеров.

ПраймерПоследовательность (5'à3')Tm (°C)Направление570gctattggagctggaattac46.0Обратный570Cgtaattccagctccaatagc46.0Прямой892Cgtcagaggtgaaattcttgg46.0Прямой1262gaacggccatgcaccac52.4Обратный1200Ccaggtctgtgatgccc42.9Прямой18S - Pg - fcaacctggttgatcctgccagt68.0Прямой18S - Pg - rctgatccttctgcaggttcacctac65.0Обратный

2.3 Клонирование 18S pДНК


Клонирование проволили через встраивание по липким концам с использованием InsT/Aclone PCR Product Cloning Kit (Fermentas) (рис. 3-4).

Лигирование осуществляли в 16 мкл смеси, содержащей до 5 ед. Т4 ДНК-лигазы, 2 мкл плазмидного вектора, 5 мкл PCR-продукта, 3 мкл 10X буфера, 1.5 мкл полиэтиленгликоля (PEG 4000) и 2.0 мкл АТФ. Смесь инкубировали при 22°С от 2 до 16 часов.

Процедура клонирования включала следующие этапы:

.Бактериальную культуру подращивали в среде С-medium около 1 часа.

.Готовили раствор TransformAidTM T-solution путем смешивания равных объемов компонентов А и В. Готовый раствор хранился на льду;

.Среду с бактериями центрифугировали при 7000 оборотах 1 минуту при 4°С, супернатант сливали;

.Бактериальный осадок ресуспендировали в 300 мкл T-solution, и ставили на 5 мин на лед;

.Клетки повторно центрифугировали при тех же условиях, супернатант сливали;

.Осадок ресуспендировали в 120 мкл T-solution, и ставили на 5 мин на лед; 2.5 мкл лигированной смеси также ставили на лед на 2 мин;

.В пробирку с лигированной смесью добавляли 50мкл бактерий в T-solution, пробирку ставили на лед на 5 мин, после чего клетки высевали на чашку с LB-ампицилиновым агаром и ставили в термостат, разогретый до 37°С на 16-18 часов.


Рис. 3 Схема плазмидного вектора pTZ57R/T. MCS - универсальный сайт для клонирования


Рис. 4. Схема лигирования по липким концам (T/A-клонирование)


Проверку наличия вставки проводили путем амплификации с праймерами М13 (-20) (Синтол) при следующих условиях: начальная денатурация - 96°С-5 мин, затем 30 циклов - 96°С-30 сек, 55°С-30 сек, 72°С-4 мин. Завершалась программа дополнительным синтезом в течение 40 минут.


2.4 Секвенирование последовательности 18S рДНК


Секвенирование осуществляли на автоматическом лазерном секвенаторе ABI Prism 3130. Реакцию секвенирования проводили в 10 мкл реакционной смеси, содержащей около 10 нг 18S рДНК, 1 пкМ праймера и 1 мкл BigDie Terminator v. 3.1. Секвенирование полноразмерной последовательности осуществляли с использованием праймеров М13 (-20) и внутренних праймеров (см. табл. 1). Условия реакции были следующими: 96°С-1мин, затем 25 циклов: 96°С-30 сек, 50°С-15 сек, 60°С-4 мин. Очистка включала осаждение ацетатом натрия и изопропанолом и последующую отмывку 96% этанолом. Перед секвенированием в пробирку с высушенным продуктом добавляли 13 мкл Hi-Di формамида, смесь затем подвергали двухминутной денатурации при 94°С.


2.5 Обработка данных секвенирования 18S рДНК


Сборку и выравнивание последовательностей гена 18S рРНК, а также расчет генетических дистанций проводили с использованием пакета программ Mega v. 4 (Kumar et. al., 2004). Расчет параметров разнообразия и генетической структуры популяций проводили с помощью программы DnaSp v. 5.

Уровень гаплотипического (аллельного) разнообразия рассчитывался как отношение числа гаплотипов (аллелей) к общему числу последовательностей.

Среднее число попарных различий рассчитывалось по формуле (Tajima, 1983):


, где

ij - количество мутаций, произошедших с момента дивергенции шаплотипов i и j;

h - число гаплотипов;

pi - частота гаплотипа i, pj - частота гаплотипа j;

n - размер выборки

Нуклеотидное разнообразие рассчитывалось по формуле (Tajima, 1983):


, где

ij - количество мутаций, произошедших с момента дивергенции шаплотипов i и j;

h - число гаплотипов;

pi - частота гаплотипа i, pj - частота гаплотипа j;

n - размер выборки;

L - количество локусов (сайтов);

2.6 Тесты для псевдогенов


Потеря функциональных ограничений и ослабленное действие отбора на псевдогенные последовательности, теоретически, может выражаться в повышении скоростей их эволюции. Это предположение мы попытались проверить при помощи двукластерного теста (Takezaki et al.,1995). Принцип этого теста состоит в проверке равенства средних частот замен для двух кластеров, образованных узлом (точкой ветвления) данного древа. Обозначим эти кластеры как А и В, а образующих их узел - N. Остальные последовательности можно обозначить как С. Тогда среднее количество наблюдаемых (оцененных) замен на сайт (дистанция) от узла N до концов кластеров А и В будет обозначено как bA и bB, соответственно. Если предположить постоянство частот замен, то ожидаемое различие (d) между bA и bB будет нулевым. Пусть LAB, LAC и LBC - средние дистанции между кластерами А и В, А и С и В и С, соответственно. Тогда:


ij - расстояние между последовательностями i и j, nA, nB и nc - количество последовательностей, входящих в кластеры А, В и С, соответственно.

Отсюда:



Следовательно, или . Если скорость эволюции кластера А медленнее, чем В, значение d будет отрицательным.

Отклонение d от нуля можно проверить при помощи двуконцевого (two-tailed) теста нормальных отклонений, используя статистическую величину Z.



Чтобы отклонить гипотезу о постоянстве скоростей нуклеотидных замен на уровне достоверности в 5%, значение Z должно быть больше или равным 1,96. Необходимо отметить, что для увеличения вероятности отклонения нулевой гипотезы о постоянстве скоростей, для внешней группы (кластер С) нужно выбирать близкородственные последовательности (Takezaki et al., 1995). Модификацией двукластерного теста является тест относительных скоростей (relative-rates test), предложенный Ли и Бускетом (Li, Bousquet, 1992) для двух поколений с одной последовательностью во внешней группе.


3. Результаты и обсуждение


Для оценки возможного числа аллельных вариантов гена 18S рРНК, PCR-продукты 1760 пн участка рибосомной ДНК амурского осетра и калуги были клонированы. Среди 22 аллельных вариантов A. schrenckii были различия по 16 однонуклеотидным и одной восьминуклеотидной вставкам, а также по 71 замене (52 транзиции и 19 трансверсий). 15 аллелей 18S рДНК H. dauricus отличались 14 однонуклеотидными и одной восьминуклеотидной вставками, а так же 58 заменами, из которых 40 транзиций и 18 трансверсий. Для сравнительного анализа полученных аллельных вариантов, наши данные были объединены с данными Генного банка по озерному осетру (Acipenser fulvescens) (GenBank).

Мутационные профили амурского осетра, калуги и озерного осетра имели выраженные отличия друг от друга (рис. 5). Основное отличие амурских видов от озерного осетра заключалось в меньшей доле транзиций. A. schrenckii отличался от А. fulvescens и калуги большим количеством делеций. Калуга отличалась от остальных видов большей долей вставок.


Рис. 5. Мутационные профили осетровых. Ts - транзиции, Tv - трансверсии, Ins - вставки, Del - делеции, Compl - мутации, включающие более трех нуклеотидов.

Анализ количества мутаций показал, что амурские виды отличаются от озерного осетра более низким количеством нуклеотидных замен в вариабельных и консервативных участках, в то время как число вставок и делеций близко по значению. Отличия между амурскими видами заключались в более высоком количестве нуклеотидных замен в консервативных и делеций в вариабельных участках (табл. 2).


Таблица 2. Количество нуклеотидных замен на одну последовательность


УчасткиКонсервативныеВариабельныеВидыAfAsHdAfAsHdзамены3,351,952,131,274,941,73вставки0,060,180,270,771,181,2делеции0,470,050,070,550,120,07- Acipenser fulvescens; As - Acipenser schrenckii; Hd - Huso dauricus.

Анализ полиморфизма последовательностей 18S рДНК, оцененного по ряду критериев не показал значительных отличий между амурскими видами (табл. 3). Примечательно только то, что H. dauricus имеет более низкий показатель нуклеотидного разнообразия. У озерного осетра оказался самый высокий уровень полиморфизма.


Таблица 3. Полиморфизм последовательностей 18S рДНК трех видов осетровых рыб

ТаксоныnShPi (SD)kA. fulvescens17131170,01525 (0,00210)26,647A. schrenckii2267220,01143 (0,00150)19,991H. dauricus1554150,00967 (0,00224)17,000

n - число клонов, S - число полиморфных (сегрегирующих) сайтов, h - число гаплотипов, Pi - нуклеотидное разнообразие (SD - стандартное отклонение), k - среднее число нуклеотидных различий.

Анализ распределения нуклеотидных замен вдоль секвенированного гена 18S рРНК показал, что первая половина гена амурских видов менее изменчива, чем у североамериканского осетра (рис 6). Вторая половина гена у амурского и озерного осетра оказалась более изменчива по сравнению с калугой. Основная часть изменчивости приходится на вариабельные участки, консервативные участки обладали наибольшей изменчивостью у A. fulvescens чем у амурских видов, что также следует и из табл. 2.

Альтернативным источником внутригеномного полиморфизма рДНК может быть присутствие псевдогенных последовательностей, которые утрачивают свои функции, и как следствие имеют пониженные селективные ограничения и повышенную аккумуляцию мутаций. Недавно возможность присутствия псевдогенов 18S рРНК обсуждалось для североамериканских видов рода Acipenser (Krieger, Fuerst, 2002 2004). В этой связи мы провели филогенетический анализ клонированных последовательностей 18S рДНК осетровых рыб Амура с целью проверки взаимоотношений между полученными последовательностями.

Филогенетическое древо, построенное по методу ближайшего соседства (Neighbour-joining - NJ) дифференцировало имеющиеся последовательности на два кластера (рис. 7). В первый, компактный кластер, входили функциональные последовательности P. spathula и A. fulvescens (Af-7 и Af-13) и гомологичные им последовательности дальневосточных видов. Второй кластер был более гетерогенным и включал наиболее дивергированные последовательности озерного осетра и осетровых рыб Амура. Поскольку входящие в первый кластер последовательности веслоноса и североамериканских видов представляют собой функциональные, или близкие к таковым, копии гена 18S рРНК (Krieger, Fuerst, 2002), то содержащиеся в этом кластере последовательности амурского осетра и калуги также можно отнести к функциональным генам. Последовательности второго кластера, очевидно, представляют собой копии с ограниченными функциями и псевдогены, т.к. входящие в него клоны A. fulvescens являются предположительными псевдогенами (Krieger, Fuerst, 2002). Таким образом, эти две группы последовательностей мы условно назвали "генами" и "псевдогенами", соответственно.


Рис. 6. Графики распределения нуклеотидных замен у: A) A. fulvescens; B) A. schrenckii; C) H. dauricus. Консервативные участки обозначены сплошной линией, вариабельные - пунктирной. 1 - петля 530; 2 - спираль 27 (конформационный переключатель); 3 - P-сайт.


В целом количество мутаций у псевдогенных последовательностей оказалось в 2-4 раза больше, чем у предположительных генов, причем последние не имели, в отличие от псевдогенов, вставок и делеций в функционально-важных областях молекулы. Для псевдогенов правомерно ожидать более высокую изменчивость по сравнению с функциональным вариантом. Действительно, уровень нуклеотидного разнообразия 18S рДНК псевдогенов в группе видов был в 2-10 раз выше, чем у генов (табл. 4). Выявленные различия, требующие специального объяснения, нашли отражение в характере распределения нуклеотидного разнообразия генов и псевдогенов вдоль исследуемого фрагмента рДНК (рис. 8). Распределение нуклеотидного разнообразия у генов и псевдогенов вдоль исследуемого гена разительно отличается, причем изменчивость генов, как и следует ожидать для функциональных последовательностей, минимальна на всем анализируемом отрезке. Примечательно, что в обеих группах сравнения псевдогены сохранили относительно консервативным участок в области 1100-1200 нуклеотидов, включающей спираль 27 (см. рис. 8).


Таблица 4. Полиморфизм последовательностей предполагаемых генов и псевдогенов

Группа сравненияnShPi (SD)kГены2774230,00406 (0,00145)7,114Псевдогены1252120,01117 (0,00179)19,621

n - число клонов, S - число полиморфных (сегрегирующих) сайтов, h - число гаплотипов, Pi - нуклеотидное разнообразие (SD - стандартное отклонение), k - среднее число нуклеотидных различий.


Рис. 7. NJ-филогенетическое древо аллельных вариантов гена 18S рРНК осетровых рыб. Цифры в узлах ветвления показывают уровень статистической поддержки.


Рис. 8. График распределения нуклеотидного разнообразия предполагаемых генов и псевдогенов осетровых рыб.


Чтобы оценить предполагаемые функциональные отличия между последовательностями рДНК первого и второго кластеров был проведен ряд дополнительных тестов. Теоретически потеря функциональных ограничений для псевдогенов определяет более высокие скорости их эволюции. Действительно, в группе видов тест относительных скоростей, основанный на генетических дистанциях двупараметрической модели Кимуры, показал, что для последовательностей кластера псевдогенов они значительно выше, чем для генов (0,016 и 0,0052, соответственно). ZnS тест Келли (Kelly, 1997), базирующийся на неравновесии по сцеплению между сегрегирующими сайтами, для информативных вариабельных сайтов выявил более существенное отклонение от нейтральности для последовательностей кластера генов (ZnS=0,11) по сравнению с псевдогенами (ZnS=0,2885), что соответствует представлениям о разном селективном давлении на кодирующие и нефункциональные последовательности ДНК

Таким образом, в геномах осетровых рыб Амура обнаруживается значительная индивидуальная изменчивость последовательностей 18S рДНК, что указывает на наличие огромного резерва разнообразия этих видов на молекулярном уровне. Результаты исследований указывают, что феномен множественности аллелей ядерных генов 18S рРНК осетров распространяется и на дальневосточные виды, следовательно, механизмы согласованной эволюции у дальневосточных представителей Acipenseridae, подобно североамериканским, не реализуются в полной мере.

Точные причины высокой внутривидовой изменчивости 18S рДНК у осетровых рыб пока неизвестны. Полиплоидная природа их генома - наиболее вероятный фактор возникновения и поддержания множественности вариантов последовательности гена 18S рРНК (Krieger, Fuerst, 2002; 2004). Происхождение множественности вариантов последовательностей рДНК у осетровых рыб могло быть вызвано полиплоидизацией по двум причинам. Гибридизация могла внести разные аллели от разных родителей, или аллополиплоидизация могла увеличить число хромосом, а также кластеров рДНК по сравнению с предковыми формами (Krieger, Fuerst, 2004).Также множественность ЯОР и их локализация на разных хромосомах может влиять на механизмы согласованной эволюции (Campbell et al., 1997). К сожалению, сведения о количестве и локализации ЯОР изучаемых нами видов в литературе отсутствуют. Полагают, что низкие скорости молекулярной эволюции, обнаруженные у видов осетровых рыб, могут существенно влиять на эффективность механизмов согласованной эволюции (Krieger, Fuerst, 2004). Возможно, существует причинная связь между размером генома и обилием копий генов.


Выводы


1.Впервые получена полная последовательность гена 18S рРНК для двух видов осетровых рыб Амура Acipenser schrenckii и Huso dauricus.

2.Проанализирована изменчивость аллельных вариантов 18S рДНК.

.Полноразмерная последовательность гена малой рибосомной субъединицы (1746 п. н.) позволяет более полно охарактеризовать выявленный уровень аллельного разнообразия по сравнению с использованным ранее 486 п. н. участком 18S рДНК.

.Данные филогенетического анализа свидетельствуют о наличии в геномах осетровых рыб последовательностей с разной функциональной значимостью, условно названных генами и псевдогенами.

.Наличие множественных нуклеотидных замен и вставок/делеций как в консервативных, так и в вариабельных участках вторичной структуры 18S рРНК подтверждает присутствие псевдогенов среди аллелей 18S рДНК.

.Сравнение скоростей эволюции последовательностей генов и псевдогенов показало, что последние действительно имеют более высокую скорость накопления нуклеотидных замен и вставок/делеций.


Список литературы


1.Apples R., Gerlach W.L., Dennis E.S., Swift H., Peacock W.J. Molecular and chromosomal organization of DNA sequences coding for the ribosomal RNAs in cereals. // Chromosoma. 1980. Vol. 78. P. 293-311.

2.Arnheim N. Concerted evolution of multigene families // Evolution of genes and proteins. 1983. Sinauer, Sunderland, Mass. P. 38-61.

.Arnheim N., Krystal M., Schmickel R., Wilson G., Ryder O., Zimmer E. Molecular evidence for genetic exchanges among ribosomal genes on nonhomologous chromosomes in man and apes. // Proceedings of the National Academy of Science, USA. 1980. Vol. 77. P. 7323-7327.

.Bemis W.E., Findeis E.K., Grande L. An overview of Acipenseriformes // Evn. Biol. Fishes, 1997 Vol. 48 P. 25-71.

.Birstein V.J. Is Acipenser medirostris one or two species? // Sturgeon Quarterly. 1993. Vol. 1 (2). P. 8.

.Birstein V.J., DeSalle R. Molecular phylogeny of Acipenserinae. // Molecular phylogenetics and evolution. 1998. Vol. 9. P. 141-155.

.Birstein V.J., Vasiliev V.P. Tetraploid-octoploid relationships and karyological evolution in the order Acipenseriformes (Pisces): karyotypes, nucleoli, and nucleolus-organizer regions in four acipenserid species. // Genetica. 1987. Vol. 73. P.3-12.

.Blacklidge K.H., Bidwell C.A. Three ploidy levels indicated by genome quantification in Acipenseriformes of North America. // J. Hered. 1993. Vol. 84. P. 427-430.

.Carlson D.M., Kettler M.K., Fisher S.E., Whitt G.S. Low genetic variability in paddlefish populations. // Copeia. 1982. Vol. 3. P. 721-723.

.Carranza S., Giribet G., Ribera C., Baguna J., Riutort M. Evidence that two types of 18S rDNA coexist in the genome of Dugesia (Schmidtea) mediterranea (Platyhelminthes, Turbellaria, Tricladida). // Molecular Biology and Evolution. 1996. Vol. 13. P. 824-832.

.Dame J.B., Sullian M., McCutchan T.F. Two major sequence classes of ribosomal RNA genes in Plasmodium berghei. // Nucleic Acids Research. 1984.Vol. 12. P. 5943-5952.

.Dingerkus G., Howell W.M. Karyotypic analysis and evidence of tetraploidy in the North American paddlefish, Polyodon spathula. // Science. 1976. Vol. 194. P. 842-843.

.Dingerkus G., Howell W.M. Karyotypic analysis and evidence of tetraploidy in the North American paddlefish, Polyodon spathula. // Science. 1976. Vol. 194. P. 842-843.

.Excoffier L., Laval G., Schneider S. Arlequin ver. 3.1: An Integrated software package for population genetics data analysis // Switzerland: Institute of Zool. Comp. and Mol. Pop. Gen. Lab. (CMPG), 2006.-145p.

.Fontana F. Chromosomal nucleolar organizer regions in four sturgeon species as markers of karyotype evolution in Acipenseriformes (Pisces). // 1994. Genome. Vol. 37. P. 888-892.

.Gunderson J.H., Sogin M.L., Wollet G., Hollingdale M., de la Cruz V.F., Waters A.P., McCutchan T.F. Structurally distinct, stage-specific ribosomes occur in Plasmodium. // Science. 1987. Vol. 238. P. 933-937.

.Hood L.E., Hunkapiller M.W., Smith L.M. Automated DNA sequencing and analysis of the human genome // Genomics. 1987. Vol. 1 (3). P. 201-212.

.Kelly J.K. A test of neutrality based on interlocus associations. // Genetics. 1997. Vol. 146. P. 1197-1206.

.Krieger J., Fuerst P.A. Characterization of nuclear 18S rRNA gene sequence diversity and expression in an individual lake sturgeon (Acipenser fulvescens) // J. Appl. Ichthyol. 2004. Vol. 20. P. 433-439.

.Krieger J., Fuerst P.A. Evidence of multiple alleles of the nuclear 18S ribosomal RNA gene in sturgeon // J.Appl/ Ichthyol. 2002. Vol. 18. P. 290-297 c.

.Krieger J., Fuerst P.A., Cavender T.M. Phylogenetic relationships of the North American sturgeons (Order Acipenseriformes) based on mitochondrial DNA sequences. // Mol. Phylo. Evol. 2000. Vol. 16 (1). P. 64-72.

22.Берг Л.С. Рыбы пресных вод СССР и сопредельных стран. Т. 1. Л.: Изд-во АН СССР. 1948. 468с.

.Васильев В.П. Эволюционная кариология рыб. М.: Наука. 1985. 300 с.

.Гриценко О.Ф., Костюнин Г.М. Амурский сиг Coregonus ussuriensis Berg и калуга Huso dauricus Georgi в сахалинских водах // Вопр. ихтиологии. 1979. Т. 19. Вып. 6. С. 1125-1128.

.Крыхтин М.Л. Современное состояние и перспективы развития осетрового хозяйства в бассейне Амура. // В сб. Биолог. Основы развития осетрового хозяйства в водоемах СССР.М.: Наука. 1979. С. 68-74.

.Маниатис Т., Фрич Э., Сэмбрук Дж. Методы генетической инженерии. Молекулярное клонирование. М.: Мир, 1984. 479 с.

.Никольский Г.В. 1956. Рыбы бассейна Амура. М.: Изд-во АН СССР

.Черешнев И.А. Состав ихтиофауны и особенности распространения пресноводных рыб в водоемах Северо-Востока СССР. // Вопр. Ихтиологии. 1990 Т. 30 Вып. 5. С. 836-844.

.Krieger J., Hett A.K., Fuerst P.A., Artyukhin E.N., Ludwig A. The molecular phylogeny of the order Acipenseriformes revisited. // J. Appl. Ichthyol. 2008. Vol. 24. P. 36-45.

.Kumar S., Tamura K., Nei M. MEGA 3: Integrated software for molecular evolutionary genetics analysis and sequence alignment // Brief. In Bioinformatics. 2004. Vol. 5 (2). P. 150-163.

.Kumar S., Tamura K., Nei M. MEGA 3: Integrated software for molecular eolutionary genetics analysis and sequence alignment // Brief. In Bioinformatics. 2004. Vol. 5. P. 150-163 c.

.Li P., Bousquet J. Relative-rate test for nucleotide substitutions between two lineages // Mol. Biol.Evol. 1992. Vol. 9. P. 1185-1189.

.Liao D., Concerted Evolution: Molecular Mechanism and Biological Implications. // Am. J. Hum. Genet. Am. J. Hum. Genet. 1999. 64:24-30 Vol.64. P.

.Liefting L.W.,Anderson M.T., Beever R.E., Gardner R.C., Forster R.L. Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma. //Applied Environmental Microbiology. 1996. Vol. 62. P. 3133-3139.

.Ludwig A. Identification of Acipenseriform species in trade. // J. Appl/ Ichthyol. 2008. Vol. 24. P. 2-19.

.Mylvaganam S., Dennis P.P. Sequence heterogeneity between the the two genes encoding 16S rRNA from the halophilic Archaebacterium Haloarcula marismrtui. // Genetics. 1992. Vol. 130. P. 399-410.

37.Nei M, Gu X, Sitnikova T (1997) Evolution by the birth-anddeath process in multigene families of the vertebrate immune system. // Proc Natl Acad Sci USA. Vol. 94. P.7799-7806.

.Ohno S., Muramoto J., Stenius C., Christian L., Kitterell W.A. Microchromosomes in holocephalian, chondrostean and holostean fishes. // Chromosoma. 1969. Vol. 226. P. 35-40.

39.Prober J.M., Trainor G.L., Dam R.J., Hobbs F.W., Robertson C.W., Zagursky R.J., Cocuzza A.J., Jensen M.A., Baumeister K. A system for rapid DNA sequencing with fluorescent chain-terminating dideoxynucleotides // Science. 1987. Vol. 238. P. 336-341.

.Qari S.H., Goldman I.F., Pieniazek N.J., Collins W.E., Lal A.A. Blood and sporozoite stage-specific small subunit ribisimal RNA-encoding genes of the human malaria parasite Plasmodium vivax. // Gene. 1994. Vol. 150. P. 43-49.

.Quari S.H., Goldman I.F., Pieniazek N.J., Collins W.E., Lal A.A. Blood and sporozoite stage-specific small subunit ribosomal RNA-encoding genes of the human malaria parasite Plasmodium vivax. // Gene. 1994. Vol. 150. P. 43-49.

.Reischel U., Feldman K., Naumann L., Gaugler B.J.M., Ninet B., Hirschel B., Emler S. 16S rRNA sequence diversity in Mycobacterium celatum strains caused by the presence of two different copies of the 16S rRNA gene. // Journal of Clinical Microbiology. 1998. Vol. 36. P. 1761-1764.

.Ruiz-Martinez M.C., Berka J., Belenkii A., Foret F., Miller A.W., Karger B.L. DNA sequencing by capillary electrophoresis with replaceable linear polyacrylamide and laser-induced fluorescence detection // Anal. Chem. 1993. Vol. 65. P. 2851-2858.

.Smith L.M., Sanders J.Z., Kaiser R.J., Hughes P., Dood C., Connell C.R., Heiner C., Kent S.B.H., Hood L.E. Fluorescence detection in automated DNA sequences analysis // Nature. 1986. Vol. 321. P. 674-679.

.Tajima F. Evolutionary relationship of DNA sequences in finite populations // Genetics. 1983. V. 105 (2). P. 437-460.

.Tajima F. Evolutionary relationship of DNA sequences in finite populations // Genetics. 1983. V. 105. P. 437-460.

.Takezaki N., Rzhetsky A., Nei M. Phylogenetic Test of the Molecular Clock and Linearized Trees // Mol.Biol.Evol. 1995. Vol. 15. P. 17-22.

.Vasileva E.D. Some morphological characteristics of Acipenserid fishes: considerations of their variability and utility in taxonomy. // Journal of Applied Ichthyology. 1999. Vol. 15. P. 32-34.

.Wang Y., Zhang Z., Ramanan N. The Actinomycete Thermobispora bispora contains two distinct types of transcriptionally active 16S rRNA genes. // Journal of Bacteriology. 1997. Vol. 179. P. 3270-3276.

.Waters A.P., Syin C., McCutchan T.F. Developmental regulation of stage-specific ribosome populations in Plasmodium. // Nature. 1989. Vol. 342. P

.Yao M.-C., Gall J.G. A single integrated gene for ribosomal RNA in a eucaryote, Tetrahymena pyriformis. // Cell. 1977. Vol. 12. P. 121-132.

.Yap W.H., Zhang Z., Wang Y. Distinct types of rRNA operons exists in the genome of the Actinomycete Thermomonospora chromogena and evidence for horizontal transfer of an entire rRNA operon. // Journal of Bacteriology. 1999. Vol. 181. P. 5201-5209.

.Zhang J., Fang Y., Hou J.Y., Ren H.J., Jiang R., Roos P., Dovichi N.J. Use of non-cross-linked polyacrylamide for four-color DNA sequencing by capillary electrophoresis separation of fragments up to 640 bases in length in two hours // Anal. Chem. 1995. Vol. 67. P. 4589-4593.


Теги: Внутрииндивидуальная изменчивость гена малой рибосомной субъединицы у осетровых рыб амура Acipenser Schrenckii Brandt, 1869 и Huso Dauricus (Georgii, 1775)  Курсовая работа (теория)  Биология
Просмотров: 26966
Найти в Wikkipedia статьи с фразой: Внутрииндивидуальная изменчивость гена малой рибосомной субъединицы у осетровых рыб амура Acipenser Schrenckii Brandt, 1869 и Huso Dauricus (Georgii, 1775)
Назад